Home / Products /Genome Editing /gRNA plasmids /hPTS gRNA1 KO plasmidhPTS gRNA2 KO plasmid

hPTS gRNA1 KO plasmidhPTS gRNA2 KO plasmid

Catalog Number: GP06913

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPTS gRNA1 KO plasmidhPTS gRNA2 KO plasmid
gRNA sequence TCGCGCTGAAGGAGATGCGGCGG(83,0.69),ACACTTGTGCCTGGCAGCGACGG(76,0.71)
Gene hPTS
Gene ID 5805
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.