Home / Products /Genome Editing /gRNA plasmids /hPTRH2 gRNA1 KO plasmidhPTRH2 gRNA2 KO plasmidhPTRH2 gRNA3 KO plasmid

hPTRH2 gRNA1 KO plasmidhPTRH2 gRNA2 KO plasmidhPTRH2 gRNA3 KO plasmid

Catalog Number: GP04297

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPTRH2 gRNA1 KO plasmidhPTRH2 gRNA2 KO plasmidhPTRH2 gRNA3 KO plasmid
gRNA sequence AACAGCCAAGCCGAGTGTACTGG(92,0.7),GCCCTCCAAATCCTTGGTTATGG(81,0.72),ATACTCGAAGGCTCCAGCCCAGG(78,0.78)
Gene hPTRH2
Gene ID 51651
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.