Home / Products /Genome Editing /gRNA plasmids /hPSMD5 gRNA1 KO plasmidhPSMD5 gRNA2 KO plasmidhPSMD5 gRNA3 KO plasmid

hPSMD5 gRNA1 KO plasmidhPSMD5 gRNA2 KO plasmidhPSMD5 gRNA3 KO plasmid

Catalog Number: GP06949

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPSMD5 gRNA1 KO plasmidhPSMD5 gRNA2 KO plasmidhPSMD5 gRNA3 KO plasmid
gRNA sequence TGCTGGCGAAGCTCGTTGAGCGG(96,0.73),CGCTGCTGAGAGAGGTAGCGAGG(83,0.66),AGCGCGCGTAGCTCCTCCAGCGG(82,0.77)
Gene hPSMD5
Gene ID 5711
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.