Home / Products /Genome Editing /gRNA plasmids /hPRRC2B gRNA1 KO plasmidhPRRC2B gRNA2 KO plasmidhPRRC2B gRNA3 KO plasmid

hPRRC2B gRNA1 KO plasmidhPRRC2B gRNA2 KO plasmidhPRRC2B gRNA3 KO plasmid

Catalog Number: GP06400

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPRRC2B gRNA1 KO plasmidhPRRC2B gRNA2 KO plasmidhPRRC2B gRNA3 KO plasmid
gRNA sequence TGGGTACTATCACGATGTTGGGG(95,0.66),TTGCAGGCGGTGGCATGCGCCGG(85,0.67),AGACTCTGTAAGCCATGTCTAGG(72,0.71)
Gene hPRRC2B
Gene ID 84726
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.