Home / Products /Genome Editing /gRNA plasmids /hPREP gRNA1 KO plasmidhPREP gRNA2 KO plasmidhPREP gRNA3 KO plasmid

hPREP gRNA1 KO plasmidhPREP gRNA2 KO plasmidhPREP gRNA3 KO plasmid

Catalog Number: GP07038

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPREP gRNA1 KO plasmidhPREP gRNA2 KO plasmidhPREP gRNA3 KO plasmid
gRNA sequence CTTGAAGTGGCAACTATACTTGG(83,0.68),CTTGAGCAGTGTCCCATCAGAGG(76,0.8),CTTATTCTGGGCCTCCACAAAGG(73,0.73)
Gene hPREP
Gene ID 5550
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.