Home / Products /Genome Editing /gRNA plasmids /hPNKD gRNA1 KO plasmidhPNKD gRNA2 KO plasmidhPNKD gRNA3 KO plasmid

hPNKD gRNA1 KO plasmidhPNKD gRNA2 KO plasmidhPNKD gRNA3 KO plasmid

Catalog Number: GP07737

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPNKD gRNA1 KO plasmidhPNKD gRNA2 KO plasmidhPNKD gRNA3 KO plasmid
gRNA sequence GCGCCATGAGCAGACCGCGGAGG(94,0.77),CAGCGGCTGCTCTTCCGAATCGG(93,0.72),GTCCTACTTGTGAGCCCCCGCGG(89,0.74)
Gene hPNKD
Gene ID 25953
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.