Home / Products /Genome Editing /gRNA plasmids /hPI4KB gRNA1 KO plasmidhPI4KB gRNA2 KO plasmidhPI4KB gRNA3 KO plasmid

hPI4KB gRNA1 KO plasmidhPI4KB gRNA2 KO plasmidhPI4KB gRNA3 KO plasmid

Catalog Number: GP04474

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPI4KB gRNA1 KO plasmidhPI4KB gRNA2 KO plasmidhPI4KB gRNA3 KO plasmid
gRNA sequence GCTAAGTGTCATCACGGAGGGGG(91,0.68),GGCCCACCAGGGAATAATGGGGG(88,0.78),ACCCCACTGGAGTTGGTCAATGG(83,0.7)
Gene hPI4KB
Gene ID 5298
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.