Home / Products /Genome Editing /gRNA plasmids /hPDK2 gRNA1 KO plasmidhPDK2 gRNA2 KO plasmidhPDK2 gRNA3 KO plasmid

hPDK2 gRNA1 KO plasmidhPDK2 gRNA2 KO plasmidhPDK2 gRNA3 KO plasmid

Catalog Number: GP04497

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPDK2 gRNA1 KO plasmidhPDK2 gRNA2 KO plasmidhPDK2 gRNA3 KO plasmid
gRNA sequence GGTGTGCTCAGCACTCGGTCGGG(89,0.75),GGTGAAGGAGGTTTTCTCACAGG(68,0.69),GTTGATCTCTTTCATGATGTTGG(63,0.68)
Gene hPDK2
Gene ID 5164
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.