Home / Products /Genome Editing /gRNA plasmids /hPAQR5 gRNA1 KO plasmidhPAQR5 gRNA2 KO plasmid

hPAQR5 gRNA1 KO plasmidhPAQR5 gRNA2 KO plasmid

Catalog Number: GP07106

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPAQR5 gRNA1 KO plasmidhPAQR5 gRNA2 KO plasmid
gRNA sequence CGAACAGGATGCCTTGCTCATGG(75,0.66),CAGGCAGTGGCAGAACTCTGTGG(60,0.7)
Gene hPAQR5
Gene ID 54852
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.