Home / Products /Genome Editing /gRNA plasmids /hNLRX1 gRNA1 KO plasmidhNLRX1 gRNA2 KO plasmidhNLRX1 gRNA3 KO plasmid

hNLRX1 gRNA1 KO plasmidhNLRX1 gRNA2 KO plasmidhNLRX1 gRNA3 KO plasmid

Catalog Number: GP06551

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNLRX1 gRNA1 KO plasmidhNLRX1 gRNA2 KO plasmidhNLRX1 gRNA3 KO plasmid
gRNA sequence GCTTCCGTGGTGGCGTATAAAGG(98,0.71),GTAGATAGCGCTCCCCCACCCGG(90,0.66),GAACAGCCGTCCATGCCTCCCGG(76,0.75)
Gene hNLRX1
Gene ID 79671
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.