Home / Products /Genome Editing /gRNA plasmids /hNEIL1 gRNA1 KO plasmidhNEIL1 gRNA2 KO plasmidhNEIL1 gRNA3 KO plasmid

hNEIL1 gRNA1 KO plasmidhNEIL1 gRNA2 KO plasmidhNEIL1 gRNA3 KO plasmid

Catalog Number: GP06552

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNEIL1 gRNA1 KO plasmidhNEIL1 gRNA2 KO plasmidhNEIL1 gRNA3 KO plasmid
gRNA sequence CAGGCGCAGCTCCTTGCCGCGGG(85,0.72),GCTGGTGTTCGGCGGCTGCGTGG(82,0.77),GCGGTAGGCACTGCTCTCAAAGG(79,0.74)
Gene hNEIL1
Gene ID 79661
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.