Home / Products /Genome Editing /gRNA plasmids /hMYL9 gRNA1 KO plasmidhMYL9 gRNA2 KO plasmid

hMYL9 gRNA1 KO plasmidhMYL9 gRNA2 KO plasmid

Catalog Number: GP04704

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMYL9 gRNA1 KO plasmidhMYL9 gRNA2 KO plasmid
gRNA sequence CCGCTGTGGCCGCTTCTTGGTGG(71,0.89),CATTGCGAAGACATTGGATGTGG(72,0.74)
Gene hMYL9
Gene ID 10398
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.