Home / Products /Genome Editing /gRNA plasmids /hMSN gRNA1 KO plasmidhMSN gRNA2 KO plasmidhMSN gRNA3 KO plasmid

hMSN gRNA1 KO plasmidhMSN gRNA2 KO plasmidhMSN gRNA3 KO plasmid

Catalog Number: GP07363

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMSN gRNA1 KO plasmidhMSN gRNA2 KO plasmidhMSN gRNA3 KO plasmid
gRNA sequence CTATTGGCTTGAGGGAAGTTTGG(73,0.65),CTTATTGAGTTTCAGCCAGGTGG(70,0.71),CTGCAGTACCAGGACACTAAAGG(62,0.72)
Gene hMSN
Gene ID 4478
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.