Home / Products /Genome Editing /gRNA plasmids /hMSH5 gRNA1 KO plasmidhMSH5 gRNA2 KO plasmidhMSH5 gRNA3 KO plasmid

hMSH5 gRNA1 KO plasmidhMSH5 gRNA2 KO plasmidhMSH5 gRNA3 KO plasmid

Catalog Number: GP04733

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMSH5 gRNA1 KO plasmidhMSH5 gRNA2 KO plasmidhMSH5 gRNA3 KO plasmid
gRNA sequence CCTTGGGTTCGCTCCTAAGGAGG(89,0.77),ACACCGCAGGGACCGAGACCTGG(87,0.74),AAGCCGGAGGAGGCCGCCCCAGG(73,0.75)
Gene hMSH5
Gene ID 4439
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.