Home / Products /Genome Editing /gRNA plasmids /hMBD4 gRNA1 KO plasmidhMBD4 gRNA2 KO plasmidhMBD4 gRNA3 KO plasmid

hMBD4 gRNA1 KO plasmidhMBD4 gRNA2 KO plasmidhMBD4 gRNA3 KO plasmid

Catalog Number: GP06310

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMBD4 gRNA1 KO plasmidhMBD4 gRNA2 KO plasmidhMBD4 gRNA3 KO plasmid
gRNA sequence TGCCGTAAGTCTGTCCCATGTGG(89,0.74),GCTCAGTTTGGTGCTACTGCAGG(80,0.72),GCGATGGGTTCTTGTAGCAAGGG(87,0.61)
Gene hMBD4
Gene ID 8930
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.