Home / Products /Genome Editing /gRNA plasmids /hMBD1 gRNA1 KO plasmidhMBD1 gRNA2 KO plasmidhMBD1 gRNA3 KO plasmid

hMBD1 gRNA1 KO plasmidhMBD1 gRNA2 KO plasmidhMBD1 gRNA3 KO plasmid

Catalog Number: GP07400

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMBD1 gRNA1 KO plasmidhMBD1 gRNA2 KO plasmidhMBD1 gRNA3 KO plasmid
gRNA sequence CGAAGTCTTTCGCAAGTCAGGGG(94,0.74),ATAGGTGTCTGAGCGTCCACAGG(90,0.81),CTGGCTGGACTGCCCGGCCCTGG(67,0.71)
Gene hMBD1
Gene ID 4152
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.