Home / Products /Genome Editing /gRNA plasmids /hMAVS gRNA1 KO plasmidhMAVS gRNA2 KO plasmidhMAVS gRNA3 KO plasmid

hMAVS gRNA1 KO plasmidhMAVS gRNA2 KO plasmidhMAVS gRNA3 KO plasmid

Catalog Number: GP01355

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAVS gRNA1 KO plasmidhMAVS gRNA2 KO plasmidhMAVS gRNA3 KO plasmid
gRNA sequence TCTTCAATACCCTTCAGCGG
Gene hMAVS
Gene ID 57506
Fluorescence/resistance EGFP/Hygro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.