Home / Products /Genome Editing /gRNA plasmids /hMAP7D1 gRNA1 KO plasmidhMAP7D1 gRNA2 KO plasmidhMAP7D1 gRNA3 KO plasmid

hMAP7D1 gRNA1 KO plasmidhMAP7D1 gRNA2 KO plasmidhMAP7D1 gRNA3 KO plasmid

Catalog Number: GP04821

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hMAP7D1 gRNA1 KO plasmidhMAP7D1 gRNA2 KO plasmidhMAP7D1 gRNA3 KO plasmid
gRNA sequence GAGGAGGTCTGGCATCCCGTGGG(88,0.74),AAGGGGACTCTTCCTGCGGGGGG(81,0.78),CTAGTGGCATTCTTCATGGCAGG(79,0.74)
Gene hMAP7D1
Gene ID 55700
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.