Home / Products /Genome Editing /gRNA plasmids /hLPL gRNA1 KO plasmidhLPL gRNA2 KO plasmidhLPL gRNA3 KO plasmid

hLPL gRNA1 KO plasmidhLPL gRNA2 KO plasmidhLPL gRNA3 KO plasmid

Catalog Number: GP07425

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hLPL gRNA1 KO plasmidhLPL gRNA2 KO plasmidhLPL gRNA3 KO plasmid
gRNA sequence ACTCTGCTACTCCGGGAATGAGG(85,0.75),CCAGCCATGGATCACCATGAAGG(70,0.71),ATTGAAATGACAGGTAGCCACGG(67,0.64)
Gene hLPL
Gene ID 4023
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.