Home / Products /Genome Editing /gRNA plasmids /hKIF2A gRNA1 KO plasmidhKIF2A gRNA2 KO plasmidhKIF2A gRNA3 KO plasmid

hKIF2A gRNA1 KO plasmidhKIF2A gRNA2 KO plasmidhKIF2A gRNA3 KO plasmid

Catalog Number: GP04932

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hKIF2A gRNA1 KO plasmidhKIF2A gRNA2 KO plasmidhKIF2A gRNA3 KO plasmid
gRNA sequence TAAGTGAAAAGATGCTCTCCAGG(70,0.72),CTTCATCAGGAACAAGGTCAGGG(70,0.65),AGGTGGAGGTGTTTCTGGACTGG(69,0.65)
Gene hKIF2A
Gene ID 3796
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.