Home / Products /Genome Editing /gRNA plasmids /hJUP gRNA1 KO plasmidhJUP gRNA2 KO plasmidhJUP gRNA3 KO plasmid

hJUP gRNA1 KO plasmidhJUP gRNA2 KO plasmidhJUP gRNA3 KO plasmid

Catalog Number: GP04953

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hJUP gRNA1 KO plasmidhJUP gRNA2 KO plasmidhJUP gRNA3 KO plasmid
gRNA sequence CGAGTGGATACCCGAGTCGTAGG(96,0.65),GAGCGTGTACTGGCGCCCGCAGG(95,0.77),CCTGATGGAGCAGCCTATCAAGG(85,0.74)
Gene hJUP
Gene ID 3728
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.