Home / Products /Genome Editing /gRNA plasmids /hIDO2 gRNA1 KO plasmidhIDO2 gRNA2 KO plasmid

hIDO2 gRNA1 KO plasmidhIDO2 gRNA2 KO plasmid

Catalog Number: GP05027

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hIDO2 gRNA1 KO plasmidhIDO2 gRNA2 KO plasmid
gRNA sequence TGGTGAGCATCAATCAATTGAGG(85,0.76),TTGTTGGCAATTTCCATCCAAGG(71,0.67)
Gene hIDO2
Gene ID 169355
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.