Home / Products /Genome Editing /gRNA plasmids /hHSPB8 gRNA1 KO plasmidhHSPB8 gRNA2 KO plasmid

hHSPB8 gRNA1 KO plasmidhHSPB8 gRNA2 KO plasmid

Catalog Number: GP07719

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHSPB8 gRNA1 KO plasmidhHSPB8 gRNA2 KO plasmid
gRNA sequence CCCGGAAGGGGTCTCGGCGCAGG(86,0.75),GCCATCATCCAGCAGGCGAGAGG(78,0.73)
Gene hHSPB8
Gene ID 26353
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.