Home / Products /Genome Editing /gRNA plasmids /hHSPA8 gRNA1 KO plasmidhHSPA8 gRNA2 KO plasmidhHSPA8 gRNA3 KO plasmid

hHSPA8 gRNA1 KO plasmidhHSPA8 gRNA2 KO plasmidhHSPA8 gRNA3 KO plasmid

Catalog Number: GP05044

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHSPA8 gRNA1 KO plasmidhHSPA8 gRNA2 KO plasmidhHSPA8 gRNA3 KO plasmid
gRNA sequence CAACCGTTCAGTGTCCGTAAAGG(86,0.73),GAAACATTGGCCCTTTATGGTGG(71,0.73),TCCAGAGGAGGTGTCTTCTATGG(60,0.69)
Gene hHSPA8
Gene ID 3312
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.