Home / Products /Genome Editing /gRNA plasmids /hHSD3B7 gRNA1 KO plasmidhHSD3B7 gRNA2 KO plasmidhHSD3B7 gRNA3 KO plasmid

hHSD3B7 gRNA1 KO plasmidhHSD3B7 gRNA2 KO plasmidhHSD3B7 gRNA3 KO plasmid

Catalog Number: GP05048

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHSD3B7 gRNA1 KO plasmidhHSD3B7 gRNA2 KO plasmidhHSD3B7 gRNA3 KO plasmid
gRNA sequence AAGCTGGTGTACCTGGTCACAGG(80,0.76),TTCGCACCACGTGCTCTCCCAGG(79,0.68),GCAGCGGGAGCCCCGGCTCGGGG(69,0.84)
Gene hHSD3B7
Gene ID 80270
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.