Home / Products /Genome Editing /gRNA plasmids /hHCFC1R1 gRNA1 KO plasmidhHCFC1R1 gRNA2 KO plasmid

hHCFC1R1 gRNA1 KO plasmidhHCFC1R1 gRNA2 KO plasmid

Catalog Number: GP05092

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHCFC1R1 gRNA1 KO plasmidhHCFC1R1 gRNA2 KO plasmid
gRNA sequence GTCACCCCCAAGGCGGCCCGCGG(83,0.74),CCCTGGGGGCCTCGCTGCAAGGG(79,0.67)
Gene hHCFC1R1
Gene ID 54985
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.