Home / Products /Genome Editing /gRNA plasmids /hH1-2 gRNA1 KO plasmidhH1-2 gRNA2 KO plasmidhH1-2 gRNA3 KO plasmid

hH1-2 gRNA1 KO plasmidhH1-2 gRNA2 KO plasmidhH1-2 gRNA3 KO plasmid

Catalog Number: GP05100

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hH1-2 gRNA1 KO plasmidhH1-2 gRNA2 KO plasmidhH1-2 gRNA3 KO plasmid
gRNA sequence GGCTGGGGGTACGCCTCGTAAGG(98,0.68),TTTACAGGGGCCTTCTCCGCAGG(88,0.67),GGGAGCGGCAGGAGCAGTCTCGG(60,0.66)
Gene hH1-2
Gene ID 3006
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.