Home / Products /Genome Editing /gRNA plasmids /hGRK6 gRNA1 KO plasmidhGRK6 gRNA2 KO plasmidhGRK6 gRNA3 KO plasmid

hGRK6 gRNA1 KO plasmidhGRK6 gRNA2 KO plasmidhGRK6 gRNA3 KO plasmid

Catalog Number: GP07637

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGRK6 gRNA1 KO plasmidhGRK6 gRNA2 KO plasmidhGRK6 gRNA3 KO plasmid
gRNA sequence CTTCGCACTGGCTGATGTGAGGG(60,0.64),TCGGAACAGCAGGCGCCCAATGG(88,0.7),CATCCAGGAAGGCGACGCAGCGG(84,0.67)
Gene hGRK6
Gene ID 2870
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.