Home / Products /Genome Editing /gRNA plasmids /hGPC4 gRNA1 KO plasmidhGPC4 gRNA2 KO plasmidhGPC4 gRNA3 KO plasmid

hGPC4 gRNA1 KO plasmidhGPC4 gRNA2 KO plasmidhGPC4 gRNA3 KO plasmid

Catalog Number: GP05126

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGPC4 gRNA1 KO plasmidhGPC4 gRNA2 KO plasmidhGPC4 gRNA3 KO plasmid
gRNA sequence CGACGTCTTTACGTGTCCAAAGG(96,0.76),GCTCAAGTCGAAAAGTTGCTCGG(85,0.66),AGTGCTCAGCGCCGCGCTGCTGG(77,0.67)
Gene hGPC4
Gene ID 2239
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.