Home / Products /Genome Editing /gRNA plasmids /hGNAI1 gRNA1 KO plasmidhGNAI1 gRNA2 KO plasmidhGNAI1 gRNA3 KO plasmid

hGNAI1 gRNA1 KO plasmidhGNAI1 gRNA2 KO plasmidhGNAI1 gRNA3 KO plasmid

Catalog Number: GP07664

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGNAI1 gRNA1 KO plasmidhGNAI1 gRNA2 KO plasmidhGNAI1 gRNA3 KO plasmid
gRNA sequence TGAAGCTGGTTATTCAGAAGAGG(67,0.76),GATCGACCGCAACCTCCGTGAGG(98,0.85),GGGCTGCACGCTGAGCGCCGAGG(65,0.84)
Gene hGNAI1
Gene ID 2770
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.