Home / Products /Genome Editing /gRNA plasmids /hGMPR gRNA1 KO plasmidhGMPR gRNA2 KO plasmidhGMPR gRNA3 KO plasmid

hGMPR gRNA1 KO plasmidhGMPR gRNA2 KO plasmidhGMPR gRNA3 KO plasmid

Catalog Number: GP05149

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGMPR gRNA1 KO plasmidhGMPR gRNA2 KO plasmidhGMPR gRNA3 KO plasmid
gRNA sequence CTCAGGGATTCCCATCATCGTGG(89,0.78),CACTGTGGGCACGTTTGAGATGG(78,0.65),CTTTGAATTTCGAAACGTGAAGG(89,0.64)
Gene hGMPR
Gene ID 2766
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.