Home / Products /Genome Editing /gRNA plasmids /hG6PC3 gRNA1 KO plasmidhG6PC3 gRNA2 KO plasmidhG6PC3 gRNA3 KO plasmid

hG6PC3 gRNA1 KO plasmidhG6PC3 gRNA2 KO plasmidhG6PC3 gRNA3 KO plasmid

Catalog Number: GP05188

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hG6PC3 gRNA1 KO plasmidhG6PC3 gRNA2 KO plasmidhG6PC3 gRNA3 KO plasmid
gRNA sequence CGCGGGCATCGTGATAGCCGAGG(98,0.84),CTACTACGCCTCCCGCCGTGTGG(97,0.81),GATCTTGGGATCGCCCAGAAAGG(91,0.73)
Gene hG6PC3
Gene ID 92579
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.