Home / Products /Genome Editing /gRNA plasmids /hFTSJ1 gRNA1 KO plasmidhFTSJ1 gRNA2 KO plasmidhFTSJ1 gRNA3 KO plasmid

hFTSJ1 gRNA1 KO plasmidhFTSJ1 gRNA2 KO plasmidhFTSJ1 gRNA3 KO plasmid

Catalog Number: GP07766

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFTSJ1 gRNA1 KO plasmidhFTSJ1 gRNA2 KO plasmidhFTSJ1 gRNA3 KO plasmid
gRNA sequence CGCCTTCAAACTGCTACAACTGG(87,0.66),TGTCTACTACCGCCTGGCCAAGG(84,0.81),GACGGACGTCAAAGGACAAGCGG(78,0.7)
Gene hFTSJ1
Gene ID 24140
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.