Home / Products /Genome Editing /gRNA plasmids /hFLII gRNA1 KO plasmidhFLII gRNA2 KO plasmidhFLII gRNA3 KO plasmid

hFLII gRNA1 KO plasmidhFLII gRNA2 KO plasmidhFLII gRNA3 KO plasmid

Catalog Number: GP07841

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFLII gRNA1 KO plasmidhFLII gRNA2 KO plasmidhFLII gRNA3 KO plasmid
gRNA sequence TGGCTGAAGCTGAACCGCACTGG(90,0.78),GCTCCTCGGGCAGGTAGCAGAGG(72,0.77),CTACTTCCCTGAGAATGTCAAGG(66,0.73)
Gene hFLII
Gene ID 2314
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.