Home / Products /Genome Editing /gRNA plasmids /hFBXW7 gRNA1 KO plasmidhFBXW7 gRNA2 KO plasmidhFBXW7 gRNA3 KO plasmid

hFBXW7 gRNA1 KO plasmidhFBXW7 gRNA2 KO plasmidhFBXW7 gRNA3 KO plasmid

Catalog Number: GP05247

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFBXW7 gRNA1 KO plasmidhFBXW7 gRNA2 KO plasmidhFBXW7 gRNA3 KO plasmid
gRNA sequence GTTGGAGTAGAACCTAGACCTGG(84,0.75),ACAGATGAATCGTGTGGTAGAGG(83,0.71),TCGGTAGATGAGGACTCCTCAGG(83,0.75)
Gene hFBXW7
Gene ID 55294
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.