Home / Products /Genome Editing /gRNA plasmids /hFASN gRNA1 KO plasmidhFASN gRNA2 KO plasmidhFASN gRNA3 KO plasmid

hFASN gRNA1 KO plasmidhFASN gRNA2 KO plasmidhFASN gRNA3 KO plasmid

Catalog Number: GP05253

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFASN gRNA1 KO plasmidhFASN gRNA2 KO plasmidhFASN gRNA3 KO plasmid
gRNA sequence TCACGGACGATGACCGTCGCTGG(99,0.83),TTCTGGGACAACCTCATCGGCGG(95,0.78),TCCTGCAAGTTCTCCGACTCTGG(91,0.66)
Gene hFASN
Gene ID 2194
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.