Home / Products /Genome Editing /gRNA plasmids /hETV7 gRNA1 KO plasmidhETV7 gRNA2 KO plasmidhETV7 gRNA3 KO plasmid

hETV7 gRNA1 KO plasmidhETV7 gRNA2 KO plasmidhETV7 gRNA3 KO plasmid

Catalog Number: GP05273

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hETV7 gRNA1 KO plasmidhETV7 gRNA2 KO plasmidhETV7 gRNA3 KO plasmid
gRNA sequence CATCTCGAACCCGTGCTCCGCGG(95,0.86),CTCAGGTCAGGGAAACGCACAGG(89,0.66),GCCGGAAGTCGTCCTTGGTGAGG(85,0.76)
Gene hETV7
Gene ID 51513
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.