Home / Products /Genome Editing /gRNA plasmids /hESD gRNA1 KO plasmidhESD gRNA2 KO plasmidhESD gRNA3 KO plasmid

hESD gRNA1 KO plasmidhESD gRNA2 KO plasmidhESD gRNA3 KO plasmid

Catalog Number: GP05280

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hESD gRNA1 KO plasmidhESD gRNA2 KO plasmidhESD gRNA3 KO plasmid
gRNA sequence TCCAGCAACAAGTGCTTTGGGGG(78,0.69),TGCTGTCTACTTACCACCAAAGG(81,0.65),GAAAGTGCCCTGCACTGTATTGG(69,0.78)
Gene hESD
Gene ID 2098
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.