Home / Products /Genome Editing /gRNA plasmids /hEPHA1 gRNA1 KO plasmidhEPHA1 gRNA2 KO plasmidhEPHA1 gRNA3 KO plasmid

hEPHA1 gRNA1 KO plasmidhEPHA1 gRNA2 KO plasmidhEPHA1 gRNA3 KO plasmid

Catalog Number: GP05302

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hEPHA1 gRNA1 KO plasmidhEPHA1 gRNA2 KO plasmidhEPHA1 gRNA3 KO plasmid
gRNA sequence CAATTGGATCTACCGCGGGGAGG(98,0.78),GGAGGCTTCCCGCGTCCACGTGG(94,0.79),GCAGTCCTGGTACATGTACAGGG(82,0.76)
Gene hEPHA1
Gene ID 2041
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.