Home / Products /Genome Editing /gRNA plasmids /hEGF gRNA1 KO plasmidhEGF gRNA2 KO plasmidhEGF gRNA3 KO plasmid

hEGF gRNA1 KO plasmidhEGF gRNA2 KO plasmidhEGF gRNA3 KO plasmid

Catalog Number: GP05332

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hEGF gRNA1 KO plasmidhEGF gRNA2 KO plasmidhEGF gRNA3 KO plasmid
gRNA sequence CAATTATGAGCAATTGGTGGTGG(75,0.79),GAGTTTTTCTGAATGGGTCAAGG(73,0.66),CCTAAAGATACTATTTCCATGGG(67,0.6)
Gene hEGF
Gene ID 1950
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.