Home / Products /Genome Editing /gRNA plasmids /hEDN1 gRNA1 KO plasmidhEDN1 gRNA2 KO plasmid

hEDN1 gRNA1 KO plasmidhEDN1 gRNA2 KO plasmid

Catalog Number: GP07963

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hEDN1 gRNA1 KO plasmidhEDN1 gRNA2 KO plasmid
gRNA sequence CTGCTGTTTGTGGCTTGCCAAGG(72,0.78),AGCGCGGTGGGTGAGAACGGCGG(88,0.79)
Gene hEDN1
Gene ID 1906
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.