Home / Products /Genome Editing /gRNA plasmids /hDYRK1A gRNA1 KO plasmidhDYRK1A gRNA2 KO plasmidhDYRK1A gRNA3 KO plasmid

hDYRK1A gRNA1 KO plasmidhDYRK1A gRNA2 KO plasmidhDYRK1A gRNA3 KO plasmid

Catalog Number: GP05350

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hDYRK1A gRNA1 KO plasmidhDYRK1A gRNA2 KO plasmidhDYRK1A gRNA3 KO plasmid
gRNA sequence GAACGGAAGGTTTACAATGATGG(81,0.79),AGACGATTCTAGTCATAAGAAGG(75,0.65),CGAAGACACCAACAGGGCCAGGG(73,0.75)
Gene hDYRK1A
Gene ID 1859
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.