Home / Products /Genome Editing /gRNA plasmids /hDNAJB4 gRNA1 KO plasmidhDNAJB4 gRNA2 KO plasmid

hDNAJB4 gRNA1 KO plasmidhDNAJB4 gRNA2 KO plasmid

Catalog Number: GP05372

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hDNAJB4 gRNA1 KO plasmidhDNAJB4 gRNA2 KO plasmid
gRNA sequence CTTGTCCGGATGAAATTTGAGGG(80,0.73),AGAGAAATATATGATCAGTTTGG(60,0.6)
Gene hDNAJB4
Gene ID 11080
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.