Home / Products /Genome Editing /gRNA plasmids /hDNAJB1 gRNA1 KO plasmidhDNAJB1 gRNA2 KO plasmidhDNAJB1 gRNA3 KO plasmid

hDNAJB1 gRNA1 KO plasmidhDNAJB1 gRNA2 KO plasmidhDNAJB1 gRNA3 KO plasmid

Catalog Number: GP07541

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hDNAJB1 gRNA1 KO plasmidhDNAJB1 gRNA2 KO plasmidhDNAJB1 gRNA3 KO plasmid
gRNA sequence CGAGATCTTCGACCGCTACGGGG(98,0.75),CGGGTCGCTGAGCACGTCGTAGG(96,0.78),TAAAGACTACTACCAGACGTTGG(86,0.65)
Gene hDNAJB1
Gene ID 3337
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.