Home / Products /Genome Editing /gRNA plasmids /hCTDSP1 gRNA1 KO plasmidhCTDSP1 gRNA2 KO plasmidhCTDSP1 gRNA3 KO plasmid

hCTDSP1 gRNA1 KO plasmidhCTDSP1 gRNA2 KO plasmidhCTDSP1 gRNA3 KO plasmid

Catalog Number: GP06909

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCTDSP1 gRNA1 KO plasmidhCTDSP1 gRNA2 KO plasmidhCTDSP1 gRNA3 KO plasmid
gRNA sequence CTTCCCAGAAGCCCCGAAGCCGG(76,0.67),TGTCTGCCGGGATGATGGGGAGG(64,0.72),AGAGTGAGTGGAGGATGCCCCGG(62,0.68)
Gene hCTDSP1
Gene ID 58190
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.