Home / Products /Genome Editing /gRNA plasmids /hCSF1R gRNA1 KO plasmidhCSF1R gRNA2 KO plasmidhCSF1R gRNA3 KO plasmid

hCSF1R gRNA1 KO plasmidhCSF1R gRNA2 KO plasmidhCSF1R gRNA3 KO plasmid

Catalog Number: GP08046

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCSF1R gRNA1 KO plasmidhCSF1R gRNA2 KO plasmidhCSF1R gRNA3 KO plasmid
gRNA sequence AACGGTGACCTTGCGATGTGTGG(93,0.76),ACGCTACCTTCCAAAACACGGGG(87,0.66),CACTGGACCCTGTACTCTGATGG(74,0.74)
Gene hCSF1R
Gene ID 1436
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.