Home / Products /Genome Editing /gRNA plasmids /hCREB3L2 gRNA1 KO plasmidhCREB3L2 gRNA2 KO plasmidhCREB3L2 gRNA3 KO plasmid

hCREB3L2 gRNA1 KO plasmidhCREB3L2 gRNA2 KO plasmidhCREB3L2 gRNA3 KO plasmid

Catalog Number: GP05470

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCREB3L2 gRNA1 KO plasmidhCREB3L2 gRNA2 KO plasmidhCREB3L2 gRNA3 KO plasmid
gRNA sequence ATGAGAGGCGCCGGGGACGTCGG(90,0.65),GGCCCGAGGCTCCTCGCACAGGG(88,0.67),AATGTGGGTGAAGGGCGACTGGG(85,0.71)
Gene hCREB3L2
Gene ID 64764
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.