Home / Products /Genome Editing /gRNA plasmids /hCRBN gRNA1 KO plasmidhCRBN gRNA2 KO plasmidhCRBN gRNA3 KO plasmid

hCRBN gRNA1 KO plasmidhCRBN gRNA2 KO plasmidhCRBN gRNA3 KO plasmid

Catalog Number: GP05471

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCRBN gRNA1 KO plasmidhCRBN gRNA2 KO plasmidhCRBN gRNA3 KO plasmid
gRNA sequence GTAATGTCTGTCCGGGAATCAGG(91,0.62),GCACGATGACGACAGCTGTCAGG(67,0.76),ATATGGAAGAATTTCATGGCAGG(63,0.66)
Gene hCRBN
Gene ID 51185
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.