Home / Products /Genome Editing /gRNA plasmids /hCORO1C gRNA1 KO plasmidhCORO1C gRNA2 KO plasmidhCORO1C gRNA3 KO plasmid

hCORO1C gRNA1 KO plasmidhCORO1C gRNA2 KO plasmidhCORO1C gRNA3 KO plasmid

Catalog Number: GP05482

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCORO1C gRNA1 KO plasmidhCORO1C gRNA2 KO plasmidhCORO1C gRNA3 KO plasmid
gRNA sequence ACTTTCACACATGCGTTGGAAGG(90,0.65),AACAGCTGGGCTAAGGAACGTGG(85,0.71),GTATGGCCCTGGTAGTCAGCTGG(82,0.75)
Gene hCORO1C
Gene ID 23603
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.