Home / Products /Genome Editing /gRNA plasmids /hCOL4A1 gRNA1 KO plasmidhCOL4A1 gRNA2 KO plasmidhCOL4A1 gRNA3 KO plasmid

hCOL4A1 gRNA1 KO plasmidhCOL4A1 gRNA2 KO plasmidhCOL4A1 gRNA3 KO plasmid

Catalog Number: GP08093

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCOL4A1 gRNA1 KO plasmidhCOL4A1 gRNA2 KO plasmidhCOL4A1 gRNA3 KO plasmid
gRNA sequence GTGCCCGGGATGCTGTTGAAAGG(83,0.68),GGTGATCCAGGTGAGATACTTGG(74,0.66),AGAGGATTTCCCGGAATCCCAGG(74,0.63)
Gene hCOL4A1
Gene ID 1282
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.